SubtiBank SubtiBank
Version comparison:

2020-01-26 12:40:412020-01-26 12:08:26

Gene

Phenotypes of a mutant

slower growth [Pubmed|26930481]

drastically reduced survival of mature dormant spores after exposure to ultrahigh vacuum desiccation and ionizing radiation that induce single strand (ss) DNA nicks and double-strand breaks (DSBs) [Pubmed|24285298]

reduced [SW|sporulation] efficiency [Pubmed|26930481]

strongly reduced chromosomal transformation rate [Pubmed|23779106,22373918]

no amplification of the [[gene|gltA]]-[[gene|gltB]] chromosomal region to suppress the glutamate auxotrophy of a [[gene|gltC]] mutant [pubmed|28294562]

sensitive to Cr(VI) treatment [pubmed|30745368]

reduced resistance towards electron beams [pubmed|31948638]

slower growth [Pubmed|26930481]

drastically reduced survival of mature dormant spores after exposure to ultrahigh vacuum desiccation and ionizing radiation that induce single strand (ss) DNA nicks and double-strand breaks (DSBs) [Pubmed|24285298]

reduced [SW|sporulation] efficiency [Pubmed|26930481]

strongly reduced chromosomal transformation rate [Pubmed|23779106,22373918]

no amplification of the [[gene|gltA]]-[[gene|gltB]] chromosomal region to suppress the glutamate auxotrophy of a [[gene|gltC]] mutant [pubmed|28294562]

sensitive to Cr(VI) treatment [pubmed|30745368]

Biological materials

Mutant

IRN444 (cat), available in [SW|Jörg Stülke]'s lab

GP2542(Δ[[gene|recA]]::spc trpC2), available in [SW|Jörg Stülke]'s lab

1A746 (Δ''recA''::''erm''), [Pubmed|1391055], available at the [http://bgsc.org/getdetail.php?bgscid=1A746 Bacillus Genetic Stock Center]

1A786 (Δ''recA''::''kan''), [Pubmed|11208805], available at the [http://bgsc.org/getdetail.php?bgscid=1A786 Bacillus Genetic Stock Center]

BP469 (Δ''recA''::''erm''), available in [SW|Fabian Commichau]'s lab

BKE16940 (''[[gene|recA]]''::''erm'', available in the [http://bgsc.org/ Bacillus Genetic Stock Center], in [SW|Fabian Commichau]'s, and in [SW|Jörg Stülke]'s labs) [pubmed|28189581]

BKE16940 ([[gene|recA]]::erm [[gene|trpC2]]) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE16940 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCTATTTTTTCCTCCTT, downstream forward: _UP4_TAAAAATAAAATAAGTTTCA

BKK16940 ([[gene|recA]]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK16940 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCTATTTTTTCCTCCTT, downstream forward: _UP4_TAAAAATAAAATAAGTTTCA

IRN444 (cat), available in [SW|Jörg Stülke]'s lab

GP2542([[gene|recA]]::spc trpC2), available in [SW|Jörg Stülke]'s lab

1A746 (''recA''::''erm''), [Pubmed|1391055], available at the [http://bgsc.org/getdetail.php?bgscid=1A746 Bacillus Genetic Stock Center]

1A786 (''recA''::''kan''), [Pubmed|11208805], available at the [http://bgsc.org/getdetail.php?bgscid=1A786 Bacillus Genetic Stock Center]

BP469 (''recA''::''erm''), available in [SW|Fabian Commichau]'s lab

BKE16940 (''[[gene|recA]]''::''erm'', available in the [http://bgsc.org/ Bacillus Genetic Stock Center], in [SW|Fabian Commichau]'s, and in [SW|Jörg Stülke]'s labs) [pubmed|28189581]

BKE16940 ([[gene|recA]]::erm [[gene|trpC2]]) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE16940 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCTATTTTTTCCTCCTT, downstream forward: _UP4_TAAAAATAAAATAAGTTTCA

BKK16940 ([[gene|recA]]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK16940 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCTATTTTTTCCTCCTT, downstream forward: _UP4_TAAAAATAAAATAAGTTTCA

References

Original publications

11814663, 16061691, 19060143, 17803906, 16024744, 17630974, 8226626, 11555642, 16479537, 19730681, 7690748, 17229847, 16267290, 20509597, 20723756, 17449621, 21278288, 22373918, 22517742, 23284295, 23536821, 21859751, 23634894, 23779106, 24285298, 24285298, 24373815, 15378759, 24362571, 8899710, 24670664, 24891441, 25138221, 25169108, 25939832, 26001966, 26786319, 26930481, 28294562, 28344191, 28911099, 30050509, 30254116, 30401797, 30745368, 30814990, 30877841, 12837805, 30975899, 30916351, 31350886, 31876108, 31948638

11814663, 16061691, 19060143, 17803906, 16024744, 17630974, 8226626, 11555642, 16479537, 19730681, 7690748, 17229847, 16267290, 20509597, 20723756, 17449621, 21278288, 22373918, 22517742, 23284295, 23536821, 21859751, 23634894, 23779106, 24285298, 24285298, 24373815, 15378759, 24362571, 8899710, 24670664, 24891441, 25138221, 25169108, 25939832, 26001966, 26786319, 26930481, 28294562, 28344191, 28911099, 30050509, 30254116, 30401797, 30745368, 30814990, 30877841, 12837805, 30975899, 30916351, 31350886, 31876108