2020-01-26 12:40:412020-01-26 12:08:26
Gene
Phenotypes of a mutant
slower growth [Pubmed|26930481]
drastically reduced survival of mature dormant spores after exposure to ultrahigh vacuum desiccation and ionizing radiation that induce single strand (ss) DNA nicks and double-strand breaks (DSBs) [Pubmed|24285298]
reduced [SW|sporulation] efficiency [Pubmed|26930481]
strongly reduced chromosomal transformation rate [Pubmed|23779106,22373918]
no amplification of the [[gene|gltA]]-[[gene|gltB]] chromosomal region to suppress the glutamate auxotrophy of a [[gene|gltC]] mutant [pubmed|28294562]
sensitive to Cr(VI) treatment [pubmed|30745368]
reduced resistance towards electron beams [pubmed|31948638]
slower growth [Pubmed|26930481]
drastically reduced survival of mature dormant spores after exposure to ultrahigh vacuum desiccation and ionizing radiation that induce single strand (ss) DNA nicks and double-strand breaks (DSBs) [Pubmed|24285298]
reduced [SW|sporulation] efficiency [Pubmed|26930481]
strongly reduced chromosomal transformation rate [Pubmed|23779106,22373918]
no amplification of the [[gene|gltA]]-[[gene|gltB]] chromosomal region to suppress the glutamate auxotrophy of a [[gene|gltC]] mutant [pubmed|28294562]
sensitive to Cr(VI) treatment [pubmed|30745368]
Biological materials
Mutant
IRN444 (cat), available in [SW|Jörg Stülke]'s lab
GP2542(Δ[[gene|recA]]::spc trpC2), available in [SW|Jörg Stülke]'s lab
1A746 (Δ''recA''::''erm''), [Pubmed|1391055], available at the [http://bgsc.org/getdetail.php?bgscid=1A746 Bacillus Genetic Stock Center]
1A786 (Δ''recA''::''kan''), [Pubmed|11208805], available at the [http://bgsc.org/getdetail.php?bgscid=1A786 Bacillus Genetic Stock Center]
BP469 (Δ''recA''::''erm''), available in [SW|Fabian Commichau]'s lab
BKE16940 (''[[gene|recA]]''::''erm'', available in the [http://bgsc.org/ Bacillus Genetic Stock Center], in [SW|Fabian Commichau]'s, and in [SW|Jörg Stülke]'s labs) [pubmed|28189581]
BKE16940 ([[gene|recA]]::erm [[gene|trpC2]]) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE16940 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCTATTTTTTCCTCCTT, downstream forward: _UP4_TAAAAATAAAATAAGTTTCA
BKK16940 ([[gene|recA]]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK16940 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCTATTTTTTCCTCCTT, downstream forward: _UP4_TAAAAATAAAATAAGTTTCA
IRN444 (cat), available in [SW|Jörg Stülke]'s lab
GP2542([[gene|recA]]::spc trpC2), available in [SW|Jörg Stülke]'s lab
1A746 (''recA''::''erm''), [Pubmed|1391055], available at the [http://bgsc.org/getdetail.php?bgscid=1A746 Bacillus Genetic Stock Center]
1A786 (''recA''::''kan''), [Pubmed|11208805], available at the [http://bgsc.org/getdetail.php?bgscid=1A786 Bacillus Genetic Stock Center]
BP469 (''recA''::''erm''), available in [SW|Fabian Commichau]'s lab
BKE16940 (''[[gene|recA]]''::''erm'', available in the [http://bgsc.org/ Bacillus Genetic Stock Center], in [SW|Fabian Commichau]'s, and in [SW|Jörg Stülke]'s labs) [pubmed|28189581]
BKE16940 ([[gene|recA]]::erm [[gene|trpC2]]) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE16940 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCTATTTTTTCCTCCTT, downstream forward: _UP4_TAAAAATAAAATAAGTTTCA
BKK16940 ([[gene|recA]]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK16940 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCTATTTTTTCCTCCTT, downstream forward: _UP4_TAAAAATAAAATAAGTTTCA
References
Original publications